Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBullet-cg-c
(Plasmid #53070)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53070 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBullet
  • Backbone manufacturer
    JBEI
  • Backbone size (bp) 8000
  • Vector type
    Synthetic Biology
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACAAGTTTGTACAAAAAAGCAGGCTTC
  • 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See http://gt.jbei.org/ for more information on the JBEI glycosyltransferase collection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBullet-cg-c was a gift from Joshua Heazlewood (Addgene plasmid # 53070 ; http://n2t.net/addgene:53070 ; RRID:Addgene_53070)
  • For your References section:

    The Plant Glycosyltransferase Clone Collection for Functional Genomics. Lao J, Oikawa A, Bromley JR, McInerney P, Suttangkakul A, Smith-Moritz AM, Plahar H, Chiu TY, Gonzalez Fernandez-Nino SM, Ebert B, Yang F, Christiansen KM, Hansen SF, Stonebloom S, Adams PD, Ronald PC, Hillson NJ, Hadi MZ, Vega-Sanchez ME, Loque D, Scheller HV, Heazlewood1 JL. Plant J. 2014 Jun 6. doi: 10.1111/tpj.12577. 10.1111/tpj.12577 PubMed 24905498