pGfa28-nLac
(Plasmid
#53130)
-
PurposeExpression of LacZ driven by partial human gfa2 promoter, expression is localized to a subset of astrocytes in mice.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC18
- Total vector size (bp) 6829
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGfa2
-
Alt nameglial fibrillary acidic protein
-
Alt nameGFAP
-
SpeciesH. sapiens (human)
-
Mutationcontains the A and B regions (bp -1757 to -1489) joined to the D region (-132 to -57) and the basal promoter (-56 to +47) with the initiating ATG mutated to TTG
-
Entrez GeneGFAP (a.k.a. ALXDRD)
- Promoter human Gfa2
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- LacZ (C terminal on insert)
- mP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
- 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is identical to pGfa2-nLac (Addgene plasmid #53126), except that the gfa2 sequences between -2163 to -1758 and between -1488 to -133 have been deleted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGfa28-nLac was a gift from Michael Brenner (Addgene plasmid # 53130 ; http://n2t.net/addgene:53130 ; RRID:Addgene_53130) -
For your References section:
Astrocyte heterogeneity revealed by expression of a GFAP-LacZ transgene. Lee Y, Su M, Messing A, Brenner M. Glia. 2006 May;53(7):677-87. 10.1002/glia.20320 PubMed 16482522