Skip to main content

pGfa28-nLac
(Plasmid #53130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53130 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18
  • Total vector size (bp) 6829
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    contains the A and B regions (bp -1757 to -1489) joined to the D region (-132 to -57) and the basal promoter (-56 to +47) with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is identical to pGfa2-nLac (Addgene plasmid #53126), except that the gfa2 sequences between -2163 to -1758 and between -1488 to -133 have been deleted.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa28-nLac was a gift from Michael Brenner (Addgene plasmid # 53130 ; http://n2t.net/addgene:53130 ; RRID:Addgene_53130)
  • For your References section:

    Astrocyte heterogeneity revealed by expression of a GFAP-LacZ transgene. Lee Y, Su M, Messing A, Brenner M. Glia. 2006 May;53(7):677-87. 10.1002/glia.20320 PubMed 16482522