Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #53130)


Item Catalog # Description Quantity Price (USD)
Plasmid 53130 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 6829
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    glial fibrillary acidic protein
  • Alt name
  • Species
    H. sapiens (human)
  • Mutation
    contains the A and B regions (bp -1757 to -1489) joined to the D region (-132 to -57) and the basal promoter (-56 to +47) with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is identical to pGfa2-nLac (Addgene plasmid #53126), except that the gfa2 sequences between -2163 to -1758 and between -1488 to -133 have been deleted.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa28-nLac was a gift from Michael Brenner (Addgene plasmid # 53130 ; ; RRID:Addgene_53130)
  • For your References section:

    Astrocyte heterogeneity revealed by expression of a GFAP-LacZ transgene. Lee Y, Su M, Messing A, Brenner M. Glia. 2006 May;53(7):677-87. 10.1002/glia.20320 PubMed 16482522