pSUPERretro-Sirt7 shRNA2
(Plasmid
#53145)
-
PurposeshRNAi vector for Sirt7
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSUPERretro
-
Backbone manufacturerOligoEngine
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSirt7
-
Alt namesirtuin 7
-
gRNA/shRNA sequencetagccatttgtccttgaggaa
- Promoter H1 RNA polymerase III
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer pLXSN5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPERretro-Sirt7 shRNA2 was a gift from Katrin Chua (Addgene plasmid # 53145 ; http://n2t.net/addgene:53145 ; RRID:Addgene_53145) -
For your References section:
SIRT7 links H3K18 deacetylation to maintenance of oncogenic transformation. Barber MF, Michishita-Kioi E, Xi Y, Tasselli L, Kioi M, Moqtaderi Z, Tennen RI, Paredes S, Young NL, Chen K, Struhl K, Garcia BA, Gozani O, Li W, Chua KF. Nature. 2012 Jul 5;487(7405):114-8. doi: 10.1038/nature11043. 10.1038/nature11043 PubMed 22722849