pSUPERretro-Sirt6 shRNA2
(Plasmid
#53148)
-
PurposeshRNAi vector for Sirt6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSUPERretro
-
Backbone manufacturerOligoEngine
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSirt6
-
Alt namesirtuin 6
-
gRNA/shRNA sequenceAAGAATGTGCCAAGTGTAAGA
- Promoter H1 RNA polymerase III
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer pLXSN5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPERretro-Sirt6 shRNA2 was a gift from Katrin Chua (Addgene plasmid # 53148 ; http://n2t.net/addgene:53148 ; RRID:Addgene_53148) -
For your References section:
SIRT6 is required for maintenance of telomere position effect in human cells. Tennen RI, Bua DJ, Wright WE, Chua KF. Nat Commun. 2011 Aug 16;2:433. doi: 10.1038/ncomms1443. 10.1038/ncomms1443 PubMed 21847107