Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGLx2-set1deltaRRM
(Plasmid #53257)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53257 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGLx2
  • Backbone size w/o insert (bp) 6442
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SET1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    3240
  • Mutation
    RRM domain deleted (aa 230-355)
  • Tag / Fusion Protein
    • LexA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer cagggcaataaagtcgaact
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLx2-set1deltaRRM was a gift from Jean Cook (Addgene plasmid # 53257 ; http://n2t.net/addgene:53257 ; RRID:Addgene_53257)
  • For your References section:

    DNA replication origin function is promoted by H3K4 di-methylation in Saccharomyces cerevisiae. Rizzardi LF, Dorn ES, Strahl BD, Cook JG. Genetics. 2012 Oct;192(2):371-84. doi: 10.1534/genetics.112.142349. Epub 2012 Jul 30. 10.1534/genetics.112.142349 PubMed 22851644