Skip to main content

pEntry Tshld(FKBP F36V)-GFP
(Plasmid #53260)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53260 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDONR 201
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4470
  • Total vector size (bp) 4073
  • Modifications to backbone
    Note that the insert was introduced by BP recombination reaction

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tshld(FKBP F36V)-GFP
  • Alt name
    FLAG tag-FRB-UbN(I13G)-T2A-FKBP*(F36V)-UbC-HA tag-GFP
  • Mutation
    FKBP F36V
  • Tags / Fusion Proteins
    • Flag (N terminal on insert)
    • HA (C terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Tshld(FKBP F36V) system allows users to fine-tune the concentration of a protein of interest in mammalian cells by titrating the concentration of non-toxic small molecule Shld1. Unlike other post-translational techniques, the Tshld(FKBP F36V) system releases its protein of interest in its native form, so it is highly attractive to be used in investigations of proteins involved in multimeric protein complexes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEntry Tshld(FKBP F36V)-GFP was a gift from Matthew Pratt (Addgene plasmid # 53260 ; http://n2t.net/addgene:53260 ; RRID:Addgene_53260)
  • For your References section:

    A Dual Small-Molecule Rheostat for Precise Control of Protein Concentration in Mammalian Cells. Lin YH, Pratt MR. Chembiochem. 2014 Mar 11. doi: 10.1002/cbic.201400006. 10.1002/cbic.201400006 PubMed 24615791