pEntry Tshld(FKBP F36V)-GFP
(Plasmid
#53260)
-
PurposepEntry Tshld(FKBP F36V)-GFP is a product of BP recombination reaction between attB flanked Tshld(F36V) system-encoded PCR product and pDonor 201 plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR 201
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4470
- Total vector size (bp) 4073
-
Modifications to backboneNote that the insert was introduced by BP recombination reaction
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTshld(FKBP F36V)-GFP
-
Alt nameFLAG tag-FRB-UbN(I13G)-T2A-FKBP*(F36V)-UbC-HA tag-GFP
-
MutationFKBP F36V
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- HA (C terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Tshld(FKBP F36V) system allows users to fine-tune the concentration of a protein of interest in mammalian cells by titrating the concentration of non-toxic small molecule Shld1. Unlike other post-translational techniques, the Tshld(FKBP F36V) system releases its protein of interest in its native form, so it is highly attractive to be used in investigations of proteins involved in multimeric protein complexes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEntry Tshld(FKBP F36V)-GFP was a gift from Matthew Pratt (Addgene plasmid # 53260 ; http://n2t.net/addgene:53260 ; RRID:Addgene_53260) -
For your References section:
A Dual Small-Molecule Rheostat for Precise Control of Protein Concentration in Mammalian Cells. Lin YH, Pratt MR. Chembiochem. 2014 Mar 11. doi: 10.1002/cbic.201400006. 10.1002/cbic.201400006 PubMed 24615791