Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMiR-CIP2A-miR-375-mutC&D
(Plasmid #53712)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53712 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMiR-Target
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9200
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CIP2A
  • Alt name
    p90
  • Alt name
    KIAA1524
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1300
  • Mutation
    Mutation on miR-375 binding site C&D (refer to citation)*
  • GenBank ID
    NM_020890.2
  • Entrez Gene
    CIP2A (a.k.a. KIAA1524, NOCIVA, p90)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Addgene quality control sequence finds one additional unreported mismatch in CIP2A. Depositor says that it is fine for distribution and should function as reported.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-CIP2A-miR-375-mutC&D was a gift from Edward Chan (Addgene plasmid # 53712 ; http://n2t.net/addgene:53712 ; RRID:Addgene_53712)
  • For your References section:

    Tumor suppressor miR-375 regulates MYC expression via repression of CIP2A coding sequence through multiple miRNA-mRNA interactions. Jung HM, Patel RS, Phillips BL, Wang H, Cohen DM, Reinhold WC, Chang LJ, Yang LJ, Chan EK. Mol Biol Cell. 2013 Jun;24(11):1638-48, S1-7. doi: 10.1091/mbc.E12-12-0891. Epub 2013 Apr 3. 10.1091/mbc.E12-12-0891 PubMed 23552692