-
PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 55202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 55202-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 55202-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL2-Luc (Addgene #26280)
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 5137
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedsRed2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1421
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC
- 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see http://www.rle.mit.edu/sbg/resources/ for more information.
DNA (Catalog # 55202-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 55202-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA was a gift from Timothy Lu (Addgene plasmid # 55202 ; http://n2t.net/addgene:55202 ; RRID:Addgene_55202) -
For your References section:
Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. 10.1016/j.molcel.2014.04.022 PubMed 24837679
Map uploaded by the depositor.
