Skip to main content

pFastBac TwinStrepII Prescission SNAPf TEV cloning vector with BioBrick polycistronic restriction sites (11-SNAP-V1)
(Plasmid #55216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55216 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac
  • Vector type
    Insect Expression
  • Tags / Fusion Proteins
    • TwinStrepII (N terminal on backbone)
    • SNAPf (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer LicBac dual V1 F (5'-cctataactattccggattattcataccgtc-3')
  • 3′ sequencing primer LicBac dual V1 Rv (5'-caggttcagggggaggtgtg-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector has a TEV cleavable TwinStrepII-Prescission-Snapf tag on the N-terminus.

Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 11 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac TwinStrepII Prescission SNAPf TEV cloning vector with BioBrick polycistronic restriction sites (11-SNAP-V1) was a gift from Scott Gradia (Addgene plasmid # 55216 ; http://n2t.net/addgene:55216 ; RRID:Addgene_55216)
  • For your References section:

    MacroBac: New Technologies for Robust and Efficient Large-Scale Production of Recombinant Multiprotein Complexes. Gradia SD, Ishida JP, Tsai MS, Jeans C, Tainer JA, Fuss JO. Methods Enzymol. 2017;592:1-26. doi: 10.1016/bs.mie.2017.03.008. Epub 2017 May 15. 10.1016/bs.mie.2017.03.008 PubMed 28668116