pAAV-Ef1a-DIO SwiChRca-TS-EYFP
(Plasmid #55631)

• Purpose: Cre-Dependent Chloride Channel
• Depositing Lab: Karl Deisseroth
• Publication: Berndt et al Science. 2014 Apr 25;344(6182):420-4. doi: 10.1126/science.1252367.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 7317
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iC1C2-TS-EYFP
• Alt name: SwiChRca
• Species: Synthetic
• Insert Size (bp): 1713
• Mutation: C128A
• Promoter: Ef1a
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry