-
PurposeCre-Dependent Chloride Channel
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7317
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiC1C2-TS-EYFP
-
Alt nameSwiChRca
-
SpeciesSynthetic
-
Insert Size (bp)1713
-
MutationC128A
- Promoter Ef1a
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO SwiChRca-TS-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55631 ; http://n2t.net/addgene:55631 ; RRID:Addgene_55631) -
For your References section:
Structure-guided transformation of channelrhodopsin into a light-activated chloride channel. Berndt A, Lee SY, Ramakrishnan C, Deisseroth K. Science. 2014 Apr 25;344(6182):420-4. doi: 10.1126/science.1252367. 10.1126/science.1252367 PubMed 24763591