p201N 3514
(Plasmid
#55769)
-
Purpose(Empty Backbone) Contains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepPZP
- Backbone size (bp) 6200
-
Modifications to backboneInclusion of aph gene for bacterial selection on kanamycin.
-
Vector typeRNAi
- Promoter GmUbi
-
Selectable markersG418, kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGAGATTGCTTCAGATCCGTA
- 3′ sequencing primer CCATTTCCATTTCACAGTTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p201N 3514 was a gift from Wayne Parrott (Addgene plasmid # 55769 ; http://n2t.net/addgene:55769 ; RRID:Addgene_55769) -
For your References section:
Simple gene silencing using the trans-acting siRNA pathway. Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. 10.1111/pbi.12362 PubMed 25816689