Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA SF-HERC2 F1
(Plasmid #55784)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55784 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 8500
  • Modifications to backbone
    The following sequence encoding 3xFLAG/STREP tag was cloned into the NheI/BamHI sites of pcDNA3.1(+): GCTAGCACGCGTCCACCATG gactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaag GGGTCGGCCTGGAGCCACCCGCAGTTCGAAAAA GGATCC
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG tagged HERC2 (1-969aa)
  • Alt name
    HERC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3000
  • GenBank ID
    NM_004667.5
  • Entrez Gene
    HERC2 (a.k.a. D15F37S1, MRT38, SHEP1, jdf2, p528)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • STREP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer TAG AAG GCA CAG TCG AGG C
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA SF-HERC2 F1 was a gift from David Chan (Addgene plasmid # 55784 ; http://n2t.net/addgene:55784 ; RRID:Addgene_55784)
  • For your References section:

    Degradation of the Deubiquitinating Enzyme USP33 is Mediated by p97 and the Ubiquitin Ligase HERC2. Chan NC, den Besten W, Sweredoski MJ, Hess S, Deshaies RJ, Chan DC. J Biol Chem. 2014 May 22. pii: jbc.M114.569392. 10.1074/jbc.M114.569392 PubMed 24855649