This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCIS GEM-CEPIA1er
(Plasmid #58217)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58217 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript SK-
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5148
  • Total vector size (bp) 6625
  • Modifications to backbone
    CAG promoter and polyA sequence were inserted.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GEM-CEPIA1er
  • Alt name
    ratiometric (blue to geen) fluorescent calcium-measuring organelle-entrapped protein indicator for the endoplasmic reticulum
  • Species
    Synthetic
  • Insert Size (bp)
    1477
  • Mutation
    GEM-GECO1 E298D F359W D400E E407D
  • Promoter CAG
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer tagagcctctgctaaccatg
  • 3′ sequencing primer tagccacctttgttcatggc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIS GEM-CEPIA1er was a gift from Masamitsu Iino (Addgene plasmid # 58217 ; http://n2t.net/addgene:58217 ; RRID:Addgene_58217)
  • For your References section:

    Imaging intraorganellar Ca(2+) at subcellular resolution using CEPIA. Suzuki J, Kanemaru K, Ishii K, Ohkura M, Okubo Y, Iino M. Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153. 10.1038/ncomms5153 PubMed 24923787