pWaldo-GFPd_PepTSt
(Plasmid
#58333)
-
PurposeExpresses the POT family transporter from Streptococcus thermophilus in E. coli as a C-terminally tagged GFP his tagged protein
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWALDOd
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7100
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsfor expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePepTSt
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)1450
- Promoter T7
-
Tag
/ Fusion Protein
- GFP-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer GAAAAGTTCTCCTCCTTTGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWaldo-GFPd_PepTSt was a gift from Simon Newstead (Addgene plasmid # 58333 ; http://n2t.net/addgene:58333 ; RRID:Addgene_58333) -
For your References section:
Alternating access mechanism in the POT family of oligopeptide transporters. Solcan N, Kwok J, Fowler PW, Cameron AD, Drew D, Iwata S, Newstead S. EMBO J. 2012 Aug 15;31(16):3411-21. doi: 10.1038/emboj.2012.157. Epub 2012 Jun 1. 10.1038/emboj.2012.157 PubMed 22659829