-
PurposeExpressed human IFITM1 with an N-terminal HA tag in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4211
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM1
-
SpeciesH. sapiens (human)
-
Entrez GeneIFITM1 (a.k.a. 9-27, CD225, DSPA2a, IFI17, LEU13)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-hIFITM1 was a gift from Howard Hang & Jacob Yount (Addgene plasmid # 58399 ; http://n2t.net/addgene:58399 ; RRID:Addgene_58399) -
For your References section:
Palmitoylome profiling reveals S-palmitoylation-dependent antiviral activity of IFITM3. Yount JS, Moltedo B, Yang YY, Charron G, Moran TM, Lopez CB, Hang HC. Nat Chem Biol. 2010 Aug;6(8):610-4. doi: 10.1038/nchembio.405. Epub 2010 Jul 4. 10.1038/nchembio.405 PubMed 20601941