pCMV-myc-mIFITM3-deltaY20
(Plasmid
#58459)
-
PurposeExpresses murine IFITM3-deltaY20 with an N-terminal myc tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-myc
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4118
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesM. musculus (mouse)
-
MutationTyrosine 20 deleted
-
Entrez GeneIfitm3 (a.k.a. 1110004C05Rik, Cd225, Cdw217, DSPA2b, Fgls, IP15, mil-1)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-mIFITM3-deltaY20 was a gift from Jacob Yount (Addgene plasmid # 58459 ; http://n2t.net/addgene:58459 ; RRID:Addgene_58459) -
For your References section:
Phosphorylation of the antiviral protein interferon-inducible transmembrane protein 3 (IFITM3) dually regulates its endocytosis and ubiquitination. Chesarino NM, McMichael TM, Hach JC, Yount JS. J Biol Chem. 2014 Apr 25;289(17):11986-92. doi: 10.1074/jbc.M114.557694. Epub 2014 Mar 13. 10.1074/jbc.M114.557694 PubMed 24627473