Skip to main content
Addgene

VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
(Plasmid #58490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58490 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW (from Addgene plasmid 22051)
  • Backbone manufacturer
    Addgene plasmid 22051
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Archaerhodopsin-3 w/ D95H point mutation fused to eGFP
  • Alt name
    Arch(D95Q)-eGFP
  • Species
    Halorubrum sodomense
  • Insert Size (bp)
    1500
  • Mutation
    Changed Aspartic Acid 95 to Glutamine
  • GenBank ID
    BAA09452.1
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ttgaactatgcgctcggggttg
  • 3′ sequencing primer cggtgaacagctcctcgcccttg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this gene (Archaerhodopsin-3) from the Boyden Lab at MIT; we made the D95Q point mutation in Archaerhodopsin-3. This gene was inserted into Addgene plasmid 22051 cut with BamHI and AgeI.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP was a gift from Adam Cohen (Addgene plasmid # 58490 ; http://n2t.net/addgene:58490 ; RRID:Addgene_58490)
  • For your References section:

    Flash memory: photochemical imprinting of neuronal action potentials onto a microbial rhodopsin. Venkatachalam V, Brinks D, Maclaurin D, Hochbaum D, Kralj J, Cohen AE. J Am Chem Soc. 2014 Feb 12;136(6):2529-37. doi: 10.1021/ja411338t. Epub 2014 Jan 27. 10.1021/ja411338t PubMed 24428326