VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
(Plasmid
#58490)
-
PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltage
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW (from Addgene plasmid 22051)
-
Backbone manufacturerAddgene plasmid 22051
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10700
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
-
Alt nameArch(D95Q)-eGFP
-
SpeciesHalorubrum sodomense
-
Insert Size (bp)1500
-
MutationChanged Aspartic Acid 95 to Glutamine
-
GenBank IDBAA09452.1
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ttgaactatgcgctcggggttg
- 3′ sequencing primer cggtgaacagctcctcgcccttg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received this gene (Archaerhodopsin-3) from the Boyden Lab at MIT; we made the D95Q point mutation in Archaerhodopsin-3. This gene was inserted into Addgene plasmid 22051 cut with BamHI and AgeI.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP was a gift from Adam Cohen (Addgene plasmid # 58490 ; http://n2t.net/addgene:58490 ; RRID:Addgene_58490) -
For your References section:
Flash memory: photochemical imprinting of neuronal action potentials onto a microbial rhodopsin. Venkatachalam V, Brinks D, Maclaurin D, Hochbaum D, Kralj J, Cohen AE. J Am Chem Soc. 2014 Feb 12;136(6):2529-37. doi: 10.1021/ja411338t. Epub 2014 Jan 27. 10.1021/ja411338t PubMed 24428326