-
PurposeExpresses the pH sensor superecliptic pHluorin in the mitochondria of mammalian cells
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneFCK(1.3)GW, from Addgene 22217
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10059
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name1xCox8 - Superecliptic pHluorin
-
SpeciesSynthetic
-
Insert Size (bp)820
-
GenBank IDAY533296
- Promoter a-CamKII
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The Cox8 mitochondrial targeting sequence was amplified from Addgene plasmid 23348, mito-PAGFP). The gene, superecliptic pHluorin, was originally obtained from Gero Miesenbock, at Memorial Sloan-Kettering Cancer Center, New York in the pGEX2T vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We obtained the gene for superecliptic pHluorin from the lab of Gero Miesenbock. Superecliptic pHluorin was first published (I believe) in: Ng, Roorda, et al. “Transmission of olfactory information between three population of neurons in the antennal lobe of the fly.” Neuron, 2002. 36(3): 463-74.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV063: 1xCox8 - superecliptic pHluorin in fck was a gift from Adam Cohen (Addgene plasmid # 58500 ; http://n2t.net/addgene:58500 ; RRID:Addgene_58500) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307