VV064: 1xCox8 - ratiometric pHluorin in fck
(Plasmid #58502)

• Purpose: Expresses the pH sensor ratiometric pHluorin in the mitochondria of mammalian cells
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 1xCox8 - Ratiometric pHluorin
• Species: Synthetic
• Insert Size (bp): 820
• GenBank ID: AF059864
• Promoter: a-CamKII

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The Cox8 mitochondrial targeting sequence was amplified from Addgene plasmid 23348, mito-PAGFP). The gene, ratiometric pHluorin, was originally obtained from Gero Miesenbock, Memorial Sloan-Kettering Cancer Center, New York in the pGEX2T vector.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ratiometric pHluorin was published in:
Miesenbock et al. “Visualizing secretion and synaptic transmission with pH-sensitive green fluorescent proteins” Nature 394, 192-195 (9 July 1998) | doi:10.1038/28190