Skip to main content

pTRF.1 udsVenus (P_JUND)
(Plasmid #58692)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58692 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRF.1-mCMV-udsVenus
  • Backbone size w/o insert (bp) 6223
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    endogenous promoter of JUND
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2159
  • Entrez Gene
    JUND (a.k.a. AP-1)
  • Tag / Fusion Protein
    • udsVenus (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer AGAAGAGGTAGGATAGGAGGGATG
  • 3′ sequencing primer gcgcaagcttcccgcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRF.1 udsVenus (P_JUND) was a gift from Kevin Janes (Addgene plasmid # 58692 ; http://n2t.net/addgene:58692 ; RRID:Addgene_58692)
  • For your References section:

    A time- and matrix-dependent TGFBR3-JUND-KRT5 regulatory circuit in single breast epithelial cells and basal-like premalignancies. Wang CC, Bajikar SS, Jamal L, Atkins KA, Janes KA. Nat Cell Biol. 2014 Apr;16(4):345-56. doi: 10.1038/ncb2930. Epub 2014 Mar 23. 10.1038/ncb2930 PubMed 24658685