pTRF.1 udsVenus (P_JUND)
(Plasmid
#58692)
-
PurposeA rapidly responsive reporter of endogenous JUND promoter activity (Lentiviral expression vector for reporter ultradestabilized Venus)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRF.1-mCMV-udsVenus
- Backbone size w/o insert (bp) 6223
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameendogenous promoter of JUND
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2159
-
Entrez GeneJUND (a.k.a. AP-1)
-
Tag
/ Fusion Protein
- udsVenus (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer AGAAGAGGTAGGATAGGAGGGATG
- 3′ sequencing primer gcgcaagcttcccgcg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRF.1 udsVenus (P_JUND) was a gift from Kevin Janes (Addgene plasmid # 58692 ; http://n2t.net/addgene:58692 ; RRID:Addgene_58692) -
For your References section:
A time- and matrix-dependent TGFBR3-JUND-KRT5 regulatory circuit in single breast epithelial cells and basal-like premalignancies. Wang CC, Bajikar SS, Jamal L, Atkins KA, Janes KA. Nat Cell Biol. 2014 Apr;16(4):345-56. doi: 10.1038/ncb2930. Epub 2014 Mar 23. 10.1038/ncb2930 PubMed 24658685