pLKO.1 shPIK3CD.v2 puro
(Plasmid
#58707)
-
PurposeLentiviral shRNA vector for knockdown of human PIK3CD
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerWeinberg Lab (Addgene plasmid 8453)
- Total vector size (bp) 7032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshPIK3CD
-
gRNA/shRNA sequenceCCGGGACCCAGAAGTGAACGACTTTCTGCAGAAAGTTCACTTCTGGGTCTTTTTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005026
-
Entrez GenePIK3CD (a.k.a. APDS, IMD14, IMD14A, IMD14B, P110DELTA, PI3K, ROCHIS, p110D)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The primers were generated by the TRC (#TRCN0000033276) Construct mildly knocks down p110d (PIK3CD) protein expression ~2 fold after 3 X 500 uL infection in MCF10A-5E cells.
The specificity of this construct has not been confirmed by addback, but a second hairpin against the same target yielded the same phenotype.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 shPIK3CD.v2 puro was a gift from Kevin Janes (Addgene plasmid # 58707 ; http://n2t.net/addgene:58707 ; RRID:Addgene_58707) -
For your References section:
Parameterizing cell-to-cell regulatory heterogeneities via stochastic transcriptional profiles. Bajikar SS, Fuchs C, Roller A, Theis FJ, Janes KA. Proc Natl Acad Sci U S A. 2014 Feb 4;111(5):E626-35. doi: 10.1073/pnas.1311647111. Epub 2014 Jan 21. 10.1073/pnas.1311647111 PubMed 24449900