Skip to main content

pX330A-1x5
(Plasmid #58769)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58769 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC ori vector
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9 nuclease
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer T3 (GCAATTAACCCTCACTAAAGG)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330A-1x5 was a gift from Takashi Yamamoto (Addgene plasmid # 58769 ; http://n2t.net/addgene:58769 ; RRID:Addgene_58769)
  • For your References section:

    Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sakuma T, Nishikawa A, Kume S, Chayama K, Yamamoto T. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. 10.1038/srep05400 PubMed 24954249