psp-161-si1(sigfp)
(Plasmid
#58801)
-
Purposeis a lentiviral vector coding the shRNA si1 (sigfp) and the gene of resistance to puromycin.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSP-161
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesi1
-
Alt namesigfp
-
Insert Size (bp)309
- Promoter Human H1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGTGGAGAGAGAGACAGAG
- 3′ sequencing primer ccacaccctaactgacacac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byParental plasmid is pSP-161 from Didier Trono's lab. Naldini et al, Science 272:263 (1996) PMID :8602510.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psp-161-si1(sigfp) was a gift from Branka Horvat (Addgene plasmid # 58801 ; http://n2t.net/addgene:58801 ; RRID:Addgene_58801)