-
PurposeConstitutive expression of tTA-EBFP fusion protein (tTA from CL-CTIG, Addgene plasmid 14901)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5412
- Total vector size (bp) 7167
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametTA transcription factor fused to enhanced blue fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)1755
- Promoter CMV
-
Tag
/ Fusion Protein
- BFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atgtctagattagataaaag
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tTA_BFP was a gift from Joshua Leonard (Addgene plasmid # 58854 ; http://n2t.net/addgene:58854 ; RRID:Addgene_58854) -
For your References section:
Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683