Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mCherry_LD 0_TEV
(Plasmid #58868)


Item Catalog # Description Quantity Price (USD)
Plasmid 58868 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5521
  • Total vector size (bp) 7090
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    MESA protease chain with mCherry ectodomain and TEV protease
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ATGTGCCGAGCCATCTCTCT
  • 3′ sequencing primer CTAATTCATGAGTTGAGTCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry_LD 0_TEV was a gift from Joshua Leonard (Addgene plasmid # 58868 ; ; RRID:Addgene_58868)
  • For your References section:

    Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683