pET-28a-GFP-Patronin CC 868–1457
(Plasmid
#59053)
-
Purposefor E. coli expression of Patronin CC truncation
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
-
Modifications to backbonevector contains a His tag, Strep tag and sfGFP; a TEV site can be used to cleave off all these tags to get a native construct
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePatronin
-
SpeciesD. melanogaster (fly)
-
Entrez GenePatronin (a.k.a. Dmel_CG33130, BcDNA:LD17191, CG18459, CG18460, CG18462, CG30102, CG33130, CG6516, Dmel\CG33130, Ssp4, l(2)k07433, ssp4)
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Strep (N terminal on insert)
- sfGFP (N terminal on insert)
- TEV (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAATTGTGAGCGGATAACAATT
- 3′ sequencing primer TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a-GFP-Patronin CC 868–1457 was a gift from Ron Vale (Addgene plasmid # 59053 ; http://n2t.net/addgene:59053 ; RRID:Addgene_59053) -
For your References section:
Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919