Skip to main content
Addgene

pET-21a-GFP-Patronin CC 534–868
(Plasmid #59054)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59054 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a
  • Modifications to backbone
    His and GFP tags added
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Patronin
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    Patronin (a.k.a. Dmel_CG33130, BcDNA:LD17191, CG18459, CG18460, CG18462, CG30102, CG33130, CG6516, Dmel\CG33130, Ssp4, l(2)k07433, ssp4)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-21a-GFP-Patronin CC 534–868 was a gift from Ron Vale (Addgene plasmid # 59054 ; http://n2t.net/addgene:59054 ; RRID:Addgene_59054)
  • For your References section:

    Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919