pET-21a-GFP-Patronin CC 534–868
(Plasmid
#59054)
-
Purposefor E. coli expression of Patronin CC truncation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21a
-
Modifications to backboneHis and GFP tags added
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePatronin
-
SpeciesD. melanogaster (fly)
-
Entrez GenePatronin (a.k.a. Dmel_CG33130, BcDNA:LD17191, CG18459, CG18460, CG18462, CG30102, CG33130, CG6516, Dmel\CG33130, Ssp4, l(2)k07433, ssp4)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-21a-GFP-Patronin CC 534–868 was a gift from Ron Vale (Addgene plasmid # 59054 ; http://n2t.net/addgene:59054 ; RRID:Addgene_59054) -
For your References section:
Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919