Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAG-FLEX-rc[Chronos-GFP]
(Plasmid #59056)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59056 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGIG
  • Backbone manufacturer
    Addgene (Plasmid 11159)
  • Backbone size w/o insert (bp) 5117
  • Total vector size (bp) 6827
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chronos-GFP
  • Alt name
    ChR90-GFP
  • Alt name
    Stigeoclonium helveticum channelrhodopsin
  • Species
    Stigeoclonium helveticum
  • Insert Size (bp)
    1710
  • GenBank ID
    KF992040.1
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer GATGTCCCCATAATTTTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositing lab sequenced this plasmid completely except for the CAG promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-FLEX-rc[Chronos-GFP] was a gift from Edward Boyden (Addgene plasmid # 59056 ; http://n2t.net/addgene:59056 ; RRID:Addgene_59056)
  • For your References section:

    Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633