-
Purpose(Empty Backbone) Mammalian DamID lentiviral vector for fusing gene of interest with Dam-V5 using Gateway cloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHIV-CS-CG
-
Backbone manufacturerPMID 9733856
-
Vector typeMammalian Expression, Lentiviral ; DamID
- Promoter Heat Shock Minimal Promoter
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus.
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- Dam (DNA adenine methyltransferase) (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pCasper-hs (GCAACTACTGAAATCTGCCAAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The V5 epitope tag serves as a linker between Dam and your favorite protein.
The lentiviral vectors can be used in two ways. When transfected as a conventional plasmid, the strong viral promoter drives high expression of the Dam(fusion) proteins. This should not be used for DamID experiments, but it is useful for checking of the proteins by Western blotting or immunofluorescence microscopy. When used as lentivirus, the strong promoter is deleted upon integration of the virus, and expression of the Dam(fusion) is now driven by the weak pIND-derived heatshock promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLgw RFC1-V5-EcoDam was a gift from Bas van Steensel (Addgene plasmid # 59205 ; http://n2t.net/addgene:59205 ; RRID:Addgene_59205) -
For your References section:
Human heterochromatin proteins form large domains containing KRAB-ZNF genes. Vogel MJ, Guelen L, de Wit E, Peric-Hupkes D, Loden M, Talhout W, Feenstra M, Abbas B, Classen AK, van Steensel B. Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12. 10.1101/gr.5391806 PubMed 17038565