-
Purpose(Empty Backbone) Drosophila DamID vector used to fuse gene of interest to Myc-tagged E.coli Dam.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCasper-hs
-
Backbone manufacturerDGRC
- Backbone size (bp) 8780
-
Modifications to backboneinserted full-length ORF of E.Coli Dam methylase followed by a myc epitope tag (EQKLISEEDL)
-
Vector typeInsect Expression ; DamID
- Promoter Drosophila heat-shock promoter
-
Tags
/ Fusion Proteins
- Dam (N terminal on backbone)
- Myc (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCasper-hs (GCAACTACTGAAATCTGCCAAG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
myc epitope tag serves as a linker peptide between dam and its fusion partner. This tag can be used to detect the fusion proteins by Western blotting or immunofluorescence microscopy to confirm their correct size and localization. Note that in order to obtain a detectable amount of protein, the fusion protein should be overexpressed by heat shock induction.
This vector can also be used to express the Dam-myc protein by itself (there is a stopcodon 15 aa after the myc-tag).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNDamMyc was a gift from Bas van Steensel (Addgene plasmid # 59217 ; http://n2t.net/addgene:59217 ; RRID:Addgene_59217) -
For your References section:
Identification of in vivo DNA targets of chromatin proteins using tethered dam methyltransferase. van Steensel B, Henikoff S. Nat Biotechnol. 2000 Apr;18(4):424-8. 10.1038/74487 PubMed 10748524