Skip to main content

pLV-Enh eGFP Reporter-muKC2-X10
(Plasmid #59234)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Brachyury-eGFP
  • Backbone size w/o insert (bp) 7967
  • Total vector size (bp) 9623
  • Modifications to backbone
    Original vector is Brachyury-eGFP (Kita-Matsuo et al. 2009) with the Brachyury promoter cloned out and replaced with the minimal Hsp68 promoter from the Hsp68-lacZ-Gateway plasmid (Pennacchio et al. 2006)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Krt6b-ex5-9
  • Alt name
    mm9 chr15:101506953-101508608
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1656
  • Promoter Mu Hsp68 minimal promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGGGATTTCAGTGCCTGTAG
  • 3′ sequencing primer CCAGGAACTGTCTCAGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the final plasmid sequence is post-Gateway recombination. The plasmid contains attB sites (not attR sites as the map implies).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-Enh eGFP Reporter-muKC2-X10 was a gift from Benjamin Yu (Addgene plasmid # 59234 ; http://n2t.net/addgene:59234 ; RRID:Addgene_59234)