-
PurposeEncodes a granzyme B FRET reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLNCX2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6097
- Total vector size (bp) 7634
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameECFP-VGPDFGR-Venus
-
Alt nameGZMB FRET reporter
-
Alt namegranzyme B FRET reporter
-
SpeciesSynthetic
-
Insert Size (bp)1537
- Promoter CMV
-
Tags
/ Fusion Proteins
- ECFP
- Venus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl2 (destroyed during cloning)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byECFP and Venus genes were cloned from Addgene 24537.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNCX2-CFP-VGPDFGR-YFP was a gift from Tim Mitchison (Addgene plasmid # 59587 ; http://n2t.net/addgene:59587 ; RRID:Addgene_59587) -
For your References section:
Imaging burst kinetics and spatial coordination during serial killing by single natural killer cells. Choi PJ, Mitchison TJ. Proc Natl Acad Sci U S A. 2013 Apr 16;110(16):6488-93. doi: 10.1073/pnas.1221312110. Epub 2013 Apr 1. 10.1073/pnas.1221312110 PubMed 23576740