Skip to main content

pLNCX2-CFP-VGPDFGR-YFP
(Plasmid #59587)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59587 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLNCX2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6097
  • Total vector size (bp) 7634
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ECFP-VGPDFGR-Venus
  • Alt name
    GZMB FRET reporter
  • Alt name
    granzyme B FRET reporter
  • Species
    Synthetic
  • Insert Size (bp)
    1537
  • Promoter CMV
  • Tags / Fusion Proteins
    • ECFP
    • Venus

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl2 (destroyed during cloning)
  • 3′ cloning site SalI (destroyed during cloning)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ECFP and Venus genes were cloned from Addgene 24537.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNCX2-CFP-VGPDFGR-YFP was a gift from Tim Mitchison (Addgene plasmid # 59587 ; http://n2t.net/addgene:59587 ; RRID:Addgene_59587)
  • For your References section:

    Imaging burst kinetics and spatial coordination during serial killing by single natural killer cells. Choi PJ, Mitchison TJ. Proc Natl Acad Sci U S A. 2013 Apr 16;110(16):6488-93. doi: 10.1073/pnas.1221312110. Epub 2013 Apr 1. 10.1073/pnas.1221312110 PubMed 23576740