pSicoR-ATF7IPi2
(Plasmid
#59615)
-
PurposeExpression of shRNA against human ATF7IP
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSicoR
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF7IP
-
gRNA/shRNA sequenceTGTAGCTACCATCTCTATGCTTACTTCTAGAGAGTAAGCATAGAGATGGTAGCTACTTTTTTC
-
SpeciesH. sapiens (human)
-
Entrez GeneATF7IP (a.k.a. AM, ATF-IP, ATF7IP1, MCAF, MCAF1, p621)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer mU6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR-ATF7IPi2 was a gift from Miguel Ramalho-Santos (Addgene plasmid # 59615 ; http://n2t.net/addgene:59615 ; RRID:Addgene_59615) -
For your References section:
Systematic Identification of Barriers to Human iPSC Generation. Qin H, Diaz A, Blouin L, Lebbink RJ, Patena W, Tanbun P, LeProust EM, McManus MT, Song JS, Ramalho-Santos M. Cell. 2014 Jul 17;158(2):449-61. doi: 10.1016/j.cell.2014.05.040. 10.1016/j.cell.2014.05.040 PubMed 25036638