pSA109
              
              
                (Plasmid
                
                #59783)
              
            
            
            
          - 
            Purposedrives ZIF-1 protein in C. elegans intestinal cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCFJ150
 - 
              Modifications to backbonevector modified to include PmeI restriction site for Gibson cloning
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert 1
- 
                Gene/Insert nameelt-2 promoter
 - 
                    SpeciesC. elegans (nematode)
 - 
                  Insert Size (bp)5002
 - 
                        Entrez Geneelt-2 (a.k.a. CELE_C33D3.1)
 
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
 - 5′ sequencing primer ggtcgagctgaatacacgtgc
 - 3′ sequencing primer CTATAATCTATTTTCTAGTTTCTATTTTATTAGAATGC (Common Sequencing Primers)
 
Gene/Insert 2
- 
                Gene/Insert namezif-1 coding sequence
 - 
                    SpeciesC. elegans (nematode)
 - 
                  Insert Size (bp)1746
 - 
                        Entrez Genezif-1 (a.k.a. CELE_F59B2.6)
 
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
 - 5′ sequencing primer atgagtgagtgttccgcgagtac
 - 3′ sequencing primer TTATTGTTGAATATTTATCGTGCACAAATTTTCGGCAG (Common Sequencing Primers)
 
Gene/Insert 3
- 
                Gene/Insert nameunc-54 3' UTR
 - 
                    SpeciesC. elegans (nematode)
 
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
 - 5′ sequencing primer gtccaattactcttcaacatccc
 - 3′ sequencing primer AAACAGTTATGTTTGGTATATTGGGAATG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pSA109 was a gift from Jeremy Nance (Addgene plasmid # 59783 ; http://n2t.net/addgene:59783 ; RRID:Addgene_59783) - 
                
For your References section:
Repurposing an endogenous degradation system for rapid and targeted depletion of C. elegans proteins. Armenti ST, Lohmer LL, Sherwood DR, Nance J. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. 10.1242/dev.115048 PubMed 25377555