pQL269
(Plasmid
#59802)
-
Purpose(Empty Backbone) The univector plasmid-fusion system (UPS) uses Cre– lox site-specific recombination to fuse a plasmid containing the gene of interest and host vectors containing regulatory information.
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepINTts
-
Backbone manufacturerHaldimann,A. and Wanner,B.L.
- Backbone size (bp) 2000
-
Modifications to backboneThe pQL269 plasmid (lac–cre,SpR, and ori Ts) was constructed by ligating the EcoRI–PvuII fragment from pQL114, containing aadA (conferring spectinomycin resistance) and the lac–cre chimeric gene, to a BglI(blunt)– EcoRI fragment containing the temperature-senstive replication origin from pINT-ts.
-
Vector typeBacterial Expression, Cre/Lox
- Promoter lambdaPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)BUN14
-
Growth instructionsTemperature sensitivity strain; grow at 42
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCAAACGGACAGAAGCATTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQL269 was a gift from Stephen Elledge (Addgene plasmid # 59802 ; http://n2t.net/addgene:59802 ; RRID:Addgene_59802) -
For your References section:
The univector plasmid-fusion system, a method for rapid construction of recombinant DNA without restriction enzymes. Liu Q, Li MZ, Leibham D, Cortez D, Elledge SJ. Curr Biol. 1998 Dec 3;8(24):1300-9. S0960-9822(07)00560-X [pii] PubMed 9843682