pMZ374
(Plasmid #59896)

• Purpose: Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).
• Depositing Lab: Mikel Zaratiegui
• Publication: Jacobs et al Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.

Backbone

• Vector backbone: pMZ283
• Backbone size w/o insert (bp): 6215
• Total vector size (bp): 10640
• Vector type: Yeast Expression, CRISPR
• Selectable markers: ura4

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Mutation: Silent muation of the CspCI site
• Promoter: adh1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCAGCCCGAGTGACAGG
• 3′ sequencing primer: TGGAGAAAGGGAAGTCTAAAAA

Gene/Insert 2

• Gene/Insert name: rrk1:sgRNA
• Promoter: rrk1

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13F
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • gRNA design and cloning for the rrk1 fission yeast CRISPR/Cas9 vectors
• Addgene Notes:
  • Addgene Diagnostic Test
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that some batches of CspCI from New England Biolabs may cut inefficiently and alters the mobility of the DNA, possibly because it remains bound to the target. The two batches that are known to work are 0041303 and 0051407. This may be due to the particular target sequence present in pMZ283 and pMZ374.