Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMZ374
(Plasmid #59896)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59896 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMZ283
  • Backbone size w/o insert (bp) 6215
  • Total vector size (bp) 10640
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    ura4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Mutation
    Silent muation of the CspCI site
  • Promoter adh1

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCAGCCCGAGTGACAGG
  • 3′ sequencing primer TGGAGAAAGGGAAGTCTAAAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rrk1:sgRNA
  • Promoter rrk1

Cloning Information for Gene/Insert 2

Resource Information

Depositor Comments

Please note that some batches of CspCI from New England Biolabs may cut inefficiently and alters the mobility of the DNA, possibly because it remains bound to the target. The two batches that are known to work are 0041303 and 0051407. This may be due to the particular target sequence present in pMZ283 and pMZ374.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ374 was a gift from Mikel Zaratiegui (Addgene plasmid # 59896 ; http://n2t.net/addgene:59896 ; RRID:Addgene_59896)
  • For your References section:

    Implementation of the CRISPR-Cas9 system in fission yeast. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. 10.1038/ncomms6344 PubMed 25352017