Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMZ222
(Plasmid #52223)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52223 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pART1
  • Backbone size w/o insert (bp) 7333
  • Total vector size (bp) 11750
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4430
  • Mutation
    silent mutation in the original CspCI site
  • Promoter adh1

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGTGCCTTCGCTTTTCTT
  • 3′ sequencing primer TGGAGGACTCGATTTAATGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ222 was a gift from Mikel Zaratiegui (Addgene plasmid # 52223 ; http://n2t.net/addgene:52223 ; RRID:Addgene_52223)
  • For your References section:

    Implementation of the CRISPR-Cas9 system in fission yeast. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. 10.1038/ncomms6344 PubMed 25352017