Skip to main content

pScalps_puro_mIL-2Rα ST
(Plasmid #59919)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59919 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pScalps
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 8547
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    interleukin 2 receptor alpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    807
  • Mutation
    changed sequence of the intracellular (C-terminal) tail Ser264 to Ala and Tyr267 to Ala
  • Entrez Gene
    Il2ra (a.k.a. CD25, Il2r, Ly-43)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BAMHI (not destroyed)
  • 3′ cloning site XHOI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps_puro_mIL-2Rα ST was a gift from Silvia Monticelli (Addgene plasmid # 59919 ; http://n2t.net/addgene:59919 ; RRID:Addgene_59919)
  • For your References section:

    Two Functionally Distinct Subsets of Mast Cells Discriminated By IL-2-Independent CD25 Activities. Deho' L, Leoni C, Brodie TM, Montagner S, De Simone M, Polletti S, Barozzi I, Natoli G, Monticelli S. J Immunol. 2014 Sep 1;193(5):2196-206. doi: 10.4049/jimmunol.1400516. Epub 2014 Jul 25. 10.4049/jimmunol.1400516 PubMed 25063866