Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pScalps_puro_mIL-2Rα RK
(Plasmid #59920)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 59920 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 8535
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    interleukin 2 receptor alpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    changed sequence of the intracellular (C-terminal) tail Arg262 to Ala and Lys263 to Gly and truncated after aa263
  • Entrez Gene
    Il2ra (a.k.a. CD25, I, Il2r, Ly-4, Ly-43)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BAMHI (not destroyed)
  • 3′ cloning site XHOI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps_puro_mIL-2Rα RK was a gift from Silvia Monticelli (Addgene plasmid # 59920 ; ; RRID:Addgene_59920)
  • For your References section:

    Two Functionally Distinct Subsets of Mast Cells Discriminated By IL-2-Independent CD25 Activities. Deho' L, Leoni C, Brodie TM, Montagner S, De Simone M, Polletti S, Barozzi I, Natoli G, Monticelli S. J Immunol. 2014 Sep 1;193(5):2196-206. doi: 10.4049/jimmunol.1400516. Epub 2014 Jul 25. 10.4049/jimmunol.1400516 PubMed 25063866