Skip to main content
Addgene
Open Menu

Eef1a-1955/-1>nls::Cas9::nls
(Plasmid #59987)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59987 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 59987-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 59987-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCESAx
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nls::Cas9::nls
  • Alt name
    Cas9; SpCas9, humanized
  • Species
    Streptococcus pyogenes
  • Mutation
    Reverted mutations from dCas9 to wiltdtype
  • Promoter Ciinte.Eef1a (EF1alpha) -1955/-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer gttagtactggttaggcgtttg
  • 3′ sequencing primer GGATTTCCTTACGCGAAATACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Eef1a-1955/-1>nls::Cas9::nls was a gift from Lionel Christiaen (Addgene plasmid # 59987 ; http://n2t.net/addgene:59987 ; RRID:Addgene_59987)

  • For your References section:

    Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740
Related items:
Commonly requested with: