Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

RFN_EGFP_83
(Plasmid #60075)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60075 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSQT1313
  • Backbone manufacturer
    Joung lab (Addgene plasmid # 53370)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pair of multiplex gRNAs targeting EGFP
  • Alt name
    EGFP gRNA pair #83
  • Promoter U6

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

Left gRNA target site: AGGAGGACGGCAACATCCTG
Right gRNA target site: CAGCTCGATGCGGTTCACCA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RFN_EGFP_83 was a gift from Keith Joung (Addgene plasmid # 60075 ; http://n2t.net/addgene:60075 ; RRID:Addgene_60075)
  • For your References section:

    Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Tsai SQ, Wyvekens N, Khayter C, Foden JA, Thapar V, Reyon D, Goodwin MJ, Aryee MJ, Joung JK. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. 10.1038/nbt.2908 PubMed 24770325