Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FL-DYSF-pUC57
(Plasmid #60177)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60177 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57-Kan
  • Backbone size w/o insert (bp) 2363
  • Total vector size (bp) 8674
  • Vector type
    cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dysferlin
  • Alt name
    DYSF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6311
  • Entrez Gene
    DYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gagcagattgtactgagagtgcacg
  • 3′ sequencing primer M13pUC-rev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The human dysferlin insert was synthesized by Genewiz

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FL-DYSF-pUC57 was a gift from Jain Foundation (Addgene plasmid # 60177 ; http://n2t.net/addgene:60177 ; RRID:Addgene_60177)