FL-DYSF-pUC57
(Plasmid
#60177)
-
PurposePlasmid contains full-length human dysferlin in a multiple cloning site of pUC57-Kan and can be easily cloned into other vectors.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC57-Kan
- Backbone size w/o insert (bp) 2363
- Total vector size (bp) 8674
-
Vector typecloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDysferlin
-
Alt nameDYSF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6311
-
Entrez GeneDYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gagcagattgtactgagagtgcacg
- 3′ sequencing primer M13pUC-rev (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human dysferlin insert was synthesized by Genewiz
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FL-DYSF-pUC57 was a gift from Jain Foundation (Addgene plasmid # 60177 ; http://n2t.net/addgene:60177 ; RRID:Addgene_60177)