Skip to main content

pCMV-DAAO
(Plasmid #60344)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60344 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pC1
  • Backbone size w/o insert (bp) 3982
  • Total vector size (bp) 5083
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DAAO
  • Species
    Synthetic
  • Insert Size (bp)
    1101
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggtgggaggtctatataag
  • 3′ sequencing primer cctctacaaatgtggtatgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-DAAO was a gift from Vsevolod Belousov (Addgene plasmid # 60344 ; http://n2t.net/addgene:60344 ; RRID:Addgene_60344)
  • For your References section:

    How much H(2)O(2) is produced by recombinant D-amino acid oxidase in mammalian cells?. Matlashov ME, Belousov VV, Enikolopov G. Antioxid Redox Signal. 2014 Mar 1;20(7):1039-44. doi: 10.1089/ars.2013.5618. Epub 2013 Oct 23. 10.1089/ars.2013.5618 PubMed 24020354