Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRS426-TUB1-internal6xHis (1-440)
(Plasmid #60391)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60391 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS426
  • Vector type
    Yeast Expression
  • Selectable markers
    URA marker for yeast

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TUB1
  • Alt name
    Yeast alpha Tubulin - delta CTT
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1500
  • Mutation
    internal 6xHis (see supplement figure 4), amino acids 1-440
  • Entrez Gene
    TUB1 (a.k.a. YML085C)
  • Promoter GAL

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aacgtcaaggagaaaaaacc
  • 3′ sequencing primer gggagggcgtgaatgtaagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS426-TUB1-internal6xHis (1-440) was a gift from Ron Vale (Addgene plasmid # 60391 ; http://n2t.net/addgene:60391 ; RRID:Addgene_60391)
  • For your References section:

    Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327