Skip to main content

pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
(Plasmid #60394)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60394 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS426
  • Vector type
    Yeast Expression
  • Selectable markers
    URA marker for yeast

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TUB1
  • Alt name
    Yeast alpha Tubulin - human TUBA1a Cterminal tail - C130S, E446C
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1500
  • Mutation
    internal 6xHis (see supplement figure 4), amino acid 1-440 yeast TUB1, 441-stop is from human TUBA1a amino acids C130S, E446C
  • Entrez Gene
    TUB1 (a.k.a. YML085C)
  • Promoter GAL

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aacgtcaaggagaaaaaacc
  • 3′ sequencing primer gggagggcgtgaatgtaagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C was a gift from Ron Vale (Addgene plasmid # 60394 ; http://n2t.net/addgene:60394 ; RRID:Addgene_60394)
  • For your References section:

    Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327