Skip to main content

pRS424-TUB2 - human TUBB1 Cterminal tail
(Plasmid #60400)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60400 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS424
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP marker for yeast

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TUB2
  • Alt name
    Yeast beta Tubulin - TUBB1 C-terminal tail
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1500
  • Mutation
    TUB2 amino acids 429 - end, replaced with human TUBB1 sequence
  • GenBank ID
    YFL037W
  • Promoter GAL

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site AatII (not destroyed)
  • 5′ sequencing primer aacgtcaaggagaaaaaacc
  • 3′ sequencing primer gggagggcgtgaatgtaagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

C-terminal tail is from TUBB1 (tubulin, beta 1 class VI) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS424-TUB2 - human TUBB1 Cterminal tail was a gift from Ron Vale (Addgene plasmid # 60400 ; http://n2t.net/addgene:60400 ; RRID:Addgene_60400)
  • For your References section:

    Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327