pHR KIF17 (1-738)
(Plasmid
#60406)
-
PurposeExpression of truncated form of human homodimeric kinesin-2 (KIF17) amino acids 1-738
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF17
-
Alt nameHomodimeric Kinesin-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3264
-
MutationTruncated version amino acids 1-738
-
Entrez GeneKIF17 (a.k.a. KIF17B, KIF3X, KLP-2, OSM-3)
- Promoter SFFV
-
Tags
/ Fusion Proteins
- sfGFP (C terminal on insert)
- GB1 (C terminal on insert)
- Strep-Tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaccctgcgccttatttgaa
- 3′ sequencing primer caatagcatgatacaaaggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR KIF17 (1-738) was a gift from Ron Vale (Addgene plasmid # 60406 ; http://n2t.net/addgene:60406 ; RRID:Addgene_60406) -
For your References section:
Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327