pHR KIF17 (1-738)
(Plasmid #60406)

• Purpose: Expression of truncated form of human homodimeric kinesin-2 (KIF17) amino acids 1-738
• Depositing Lab: Ron Vale
• Publication: Sirajuddin et al Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16.

Backbone

• Vector backbone: pHR
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KIF17
• Alt name: Homodimeric Kinesin-2
• Species: H. sapiens (human)
• Insert Size (bp): 3264
• Mutation: Truncated version amino acids 1-738
• Entrez Gene: KIF17 (a.k.a. KIF17B, KIF3X, KLP-2, OSM-3)
• Promoter: SFFV
• Tags / Fusion Proteins:
  • sfGFP (C terminal on insert)
  • GB1 (C terminal on insert)
  • Strep-Tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaccctgcgccttatttgaa
• 3′ sequencing primer: caatagcatgatacaaaggc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry